Skip to main content

Table 1 List of primers used to construct GFP-expressing plasmid, pBS-EGRADE

From: Establishment of transient and stable transfection systems for Babesia ovata

Primer Sequence
BoefIG2-F-ClaI-IF AGGTCGACGGTATCGATCACTCATTTAGATTGCGA
BoefIG2-R-ClaI-IF ATATCAAGCTTATCGATCTTGTTTAAGGTTTAACGA
eGFP-F-HindIII-IF CAAGATCGATAAGCTTATGGTGAGCAAGGGCGAGGA
eGFP-R-HindIII-IF TCCCGATATCAAGCTTTTACTTGTACAGCTCGTCCA
BoRAPIG-F-EcoRV-IF ATCGATAAGCTTGATATCGGGAGCAGAGCTCTGGCCA
BoRAPIG-R-EcoRV-IF CTGCAGGAATTCGATATCCGTAAAGCGAGACGGGGA
BoActin5UTR-F-SmaI-IF GAATTCCTGCAGCCCGGGCACATAAAGGTACCTATGCT
BoActin5UTR-R-SmaI-IF ACTAGTGGATCCCCCGGGCTTGGCGAAATTTTACTCCT
hDHFR-F-BamHI-IF CAAGCCCGGGGGATCCATGGTTGGTTCGCTAAACT
hDHFR-R-BamHI-IF ACGTACTAGTGGATCCTTAATCATTCTTCTCATATAC
Boef3UTR-F-SpeI-IF CGGGGGATCCACTAGTACGTTGCGCCTTTAGGTGCA
Boef3UTR-R-SpeI-IF CCGCTCTAGAACTAGTGGTGTGAGCATTGCTTGTC
BoADE-F-EcoRI-IF TACGGATATCGAATTCCTGCAGCCCGGGCACATAAAGG
BoADE-R-EcoRI-IF CGGGCTGCAGGAATTCACTAGTGGTGTGAGCATTGC
  1. Restriction enzyme sites are underlined