Skip to main content

Advertisement

Table 1 Primer sequences and annealing temperatures (Ta) for species-specific PCR reactions

From: Effect of anthelmintic treatment strategy on strongylid nematode species composition in grazing lambs in Scotland

Species Primer Sequence Ta Product size Reference
Chabertia ovina CHO GATGACCTCGTTGTCACCGTG 55 °C 162 bp [30]
NC2 TTAGTTTCTTTTCCTCCGCT
Oesophagostomum venulosum OEV TGAAATGAGACAACCGTAGTCG 55 °C 105 bp [30]
NC2 TTAGTTTCTTTTCCTCCGCT
Cooperia curticei CcF TATACTACAGTGTGGCTAGCG 52 °C 143 bp [17]
CcR TCATACCATTCAGAAATGTTC