Skip to main content

Table 1 Diptera-specific PCR primers designed in this study

From: Ecological characterization and molecular differentiation of Culex pipiens complex taxa and Culex torrentium in eastern Austria

Specifity Genetic marker Primer Sequences of primer (5′–3′) Amplicon size
Diptera COI H15CuliCOIFw AGCCATTTAATCGCGACAA 750
   H15CuliCOIRv GGATGTCCAAAAAATCAAAATAAATGTT