Skip to main content

Table 1 Primer sets employed for PCR amplification

From: Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle

PCR target Primer Sequence (5′– 3′) Reference
Theileria/Babesia spp. 18S rDNA Forward (RLB-F2) GACACAGGGAGGTAGTGACAAG [20]
Reverse (RLB-R2) Biotin-CTAAGAATTTCACCTCTGACAGT
Ehrlichia/Anaplasma spp. 16S rDNA Forward (16S8FE) GGAATTCAGAGTTGGATC(A/C)TGG(C/T)TCAG [21]
Reverse (BGA1B-new) Biotin-CGGGATCCCGAGTTTGCCGGGACTT(C/T)TTCT [22]
Rickettsia spp. 16S rDNA Forward (Rick-F1) GAACGCTATCGGTATGCTTAACACA [23]
Reverse (Rick-R2) Biotin-CATCACTCACTCGGTATTGCTGGA