Skip to main content

Table 2 Genus- and species-specific probes employed for reverse line blotting

From: Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle

  Tick-borne Microorganism’s Genera/Species Probe Sequence (from 5′–3′) Tm* (°C) Reference
1 Ehrlichia/Anaplasma catch-all GGGGGAAAGATTTATCGCTA 58 [22]
2 Anaplasma bovis GTAGCTTGCTATG(A/G)GAACA 56–58 [20]
3 Anaplasma centrale TCGAACGGACCATACGC 61 [22]
4 Anaplasma marginale GACCGTATACGCAGCTTG 59 [22]
5 Ehrlichia ruminantium AGTATCTGTTAGTGGCAG 54 [22]
6 Anaplasma sp. (Omatjenne) CGGATTTTTATCATAGCTTGC 57 [22]
7 Theileria/Babesia catch-all TAATGGTTAATAGGA(A/G)C(A/G)GTTG 55–59 [25]
8 Babesia catch-all 1 ATTAGAGTGTTTCAAGCAGAC 57 Nijhof (unpublished)
9 Babesia catch-all 2 ACTAGAGTGTTTCAAACAGGC 60 Nijhof (unpublished)
10 Babesia bigemina CGTTTTTTCCCTTTTGTTGG 58 [24]
11 Babesia bovis CAGGTTTCGCCTGTATAATTGAG 61 [24]
12 Theileria annulata CCTCTGGGGTCTGTGCA 62 [20]
13 Theileria buffeli GGCTTATTTCGG(A/T)TTGATTTT 56–57 [24]
14 Theileria mutans CTTGCGTCTCCGAATGTT 59 [24]
15 Theileria parva GGACGGAGTTCGCTTTG 60 [26]
16 Theileria taurotragi TCTTGGCACGTGGCTTTT 62 [24]
17 Theileria velifera CCTATTCTCCTTTACGAGT 54 [24]
18 Rickettsia catch-all TTTAGAAATAAAAGCTAATACCG 54 [27]
  1. *Tm = melting temperature