Skip to main content

Table 1 Primers

From: The sandfly Lutzomyia longipalpis LL5 embryonic cell line has active Toll and Imd pathways and shows immune responses to bacteria, yeast and Leishmania

Name Sequence
CactusDS-F 5‘ TGGCGCCCCTAGATGCGGTGATTCGGGCTTTAT 3‘
CactusDS-R 5‘ TGGCGCCCCTAGATGGCAGGGGTAGGGATTCATT 3‘
CactusRT-F 5‘ CTAATCCGAATGAATCCCTACCC 3‘
CactusRT-R 5‘ GACCCACGATCACGGCTAGA 3‘
CasparDS-F 5‘ TGGCGCCCCTAGATGAACCCAGTGGTGATTTCCTCG 3‘
CasparDS-R 5‘ TGGCGCCCCTAGATGATAGCGTTTCATCTGCATCCATC 3‘
CasparRT-F 5‘ CCAAAGAGGAGGCAAGAAAGA 3‘
CasparRT-R 5‘ TTCCGCTTCAAGACGCATA 3‘
LucDS-F 5‘ TCCATTCGGTTGGCAGA 3‘
LucDS-R 5‘ CCGTGATGGAATGGAACA 3‘
Attacin-F 5‘ AGGCTGATCCTCTGGGTCCTGT 3‘
Attacin-R 5‘ ATGGGCATGGCAGCGTCTCT 3‘
Cecropin-F 5‘ TGGCAGTCCTGACCACTGGA 3‘
Cecropin-R 5‘ CTTCTCCACTGAACGGTGAACG 3‘
Defensin-2-F 5‘ ATCCATCCTTTATGCAACCG 3‘
Defensin-2-R 5‘ GCCTTTGAGTCGCAGTATCC 3‘
Dorsal-F 5‘ CAATCTCGTGGGAAAGGATG 3‘
Dorsal-R 5‘ ACCCGGAGAGCTTCTTCAAT 3‘
Relish-F 5‘ ACGGGATTGCTCTGACTACG 3‘
Relish-R 5‘ ACGGCTTGTAGGTGAAGTGC 3‘
RP49-F 5‘ GACCGATATGCCAAGCTAAAGCA 3‘
RP49-R 5‘ GGGGAGCATGTGGCGTGTCTT 3‘
T7-Primer 5‘ CCGTAATACGACTCACTATAGGGTGGCGCCCCTAGATG 3‘