Skip to main content

Table 1 Target genes and primers used for PCR to detect and characterize Borrelia persica in blood samples from cats and dogs

From: Borrelia persica infection in dogs and cats: clinical manifestations, clinicopathological findings and genetic characterization

Target gene Primers Primer sequence (5’ to 3’) Reference
16S rRNA REC4 ATGCTAGAAACT GCATGA [20]
REC9 TCGTCTGAGTCCCCATCT
flab Bfpbu GCT GAA GAG CTTGGAATGCAACC [21]
Bfpcr TGATCAGTTATCATTCTAATAGCA
GlpQ 128f CAGAACATACCT TAGAAGCTCAAGC [22]
340r GTGATTTGATTTCTGCTAATGTG