Skip to main content

Table 1 Primers employed for A. marginale identification and characterization

From: Molecular identification of Anaplasma marginale in two autochthonous South American wild species revealed an identical new genotype and its phylogenetic relationship with those of bovines

Gene Product Primer sequence Amplicon size (bp) Reference
msp5 major surface protein MSP5 F: 5' GCATAGCCTCCCCCTCTTTC 3' 548 [9]
R: 5' TCCTCGCCTTGCCCCTCAGA 3'
F: 5' TACACGTGCCCTACCGACTTA 3' 345
R: 5' TCCTCGCCTTGCCCCTCAGA 3'
msp1α major surface protein MSP1a F: 5'GCATTACAACGCAACGCTTGAG 3' 84–87 bp tandem repeats [10]
R: 5'GCTTTACGCCGCCGCCTGCGCC 3'
dnaA Chromosomal replication initiation protein F: 5' GTTCATAAGCGGGAAGGACA 3' 512 [11]
R: 5' CTTGTCTCGGTCTGGCTAGG 3'
ftsZ Cell division protein FtsZ F: 5' CCTGACCACCAATCCGTATC 3' 575
R: 5' CCCGTATGAAGCACCGTATC 3'
groEl Chaperonin GroEL F: 5' AGCATAAAGCCCGAGGAACCTT 3' 699
R: 5' GCCGAGCATGTCCTTCCTTCTG 3'
lipA Lipoyl synthase F: 5' TGTGGATAGGGACGACCTTC 3' 538
R: 5' AAAGTCATCCTCAGCGTGGT 3'
recA Recombinase A F: 5' GGGCGGTAACTGTGCTTTTA 3' 579
R: 5' ACGCCCATGTCGACTATCTC 3'
secY Preprotein translocase subunit SecY F: 5' TTCACGCTGCTAGCCCTAAT 3' 501
R: 5' TACGAGGGAAATGCCGTTAC 3'
sucB Dihydrolipoamide acetyltransferase component F: 5' GAGATAGCATCTCCGGTTGC 3' 808
R: 5' CTCCCCTGGCCTTTTTACTC 3'