Skip to main content

Table 3 List of primers used in SYBR Green qRT-PCR

From: Hydatid cyst fluid promotes peri-cystic fibrosis in cystic echinococcosis by suppressing miR-19 expression

Gene Sequence (5′ to 3′)
Homo sapiens COL1A1 Forward CATGTTCAGCTTTGTGGACCTC
(NM_000088.3) Reverse TCACAGATCACGTCATCGCA
Homo sapiens COL3A1 Forward CTTCTCTCCAGCCGAGCTTC
(NM_000090.3) Reverse GTAGTCTCACAGCCTTGCGT
Homo sapiens TβRII Forward GTAGCTCTGATGAGTGCAATGAC
(NM_003242.5) Reverse CAGATATGGCAACTCCCAGTG
Homo sapiens α-SMA Forward CAGCCAAGCACTGTCAGGAAT
(NM_001613.2) Reverse TTTGCTCTGTGCTTCGTCAC
Homo sapiens β-actin Forward TGGCACCCAGCACAATGAA
(NM_001101.3) Reverse CTAAGTCATAGTCCGCCTAGAAGCA