Skip to main content

Advertisement

Table 1 List of the primers used in the study

From: First detection of Candidatus Rickettsia barbariae in the flea Vermipsylla alakurt from north-western China

Gene Primer Sequence (5′–3′) Reference
18S rDNA 18Sai CCTGAGAAACGGCTACCACATC [26]
  18S7R GCATCACAGACCTGTTATTGC [26]
28S rDNA 28SrD3.2a AGTACGTGAAACCGTTCASGGGT [26]
  28SrD5b CCACAGCGCCAGTTCTGCTTAC [26]
COII A-tLEU ATGGCAGATTAGTGCAATGG [27]
  B-tLYS GTTTAAGAGACCAGTACTTG [27]
EF-1a EF-1a-F GGACACAGAGATTTCATCAAGAACA This study
  EF-1a-R GCAATGTGRGCHGTGTGGCA This study
ompB ompB-F ATTTACAAGCAGGTGGTG This study
  ompB-R GCAGTGTTACCGGGATTG This study
geneD geneD-F CGGTAACCTAGATACAAGTGA This study
  geneD-R TATAAGCTATTGCGTCATCTC This study