Skip to main content

Table 2 Primers used in RT-qPCR

From: Dynamics of pyrethroid resistance in malaria vectors in southern Benin following a large scale implementation of vector control interventions

Primer Accession number Primer sequence (5'–3') PCR efficiency (%)
CYP6M2 VectorBase: AGAP008212 Fw: TCGGGATGTGTGCGTTCGGC 100
Rv: TCGTGTCTCGCACCGCGTTC  
GSTD3 VectorBase: AGAP004382 Fw: CTAAGCTTAATCCGCAACATACCA  
Rv: GTGTCATCCTTGCCGTACAC 93
RPS7 VectorBase: AGAP010592 Fw: ATTGCCGAGCGCCGCATTCT  
Rv: GACGCGGATACGCTTGCCGA 100
CYP6P3 VectorBase: AGAP002865 Fw: TGTGATTGACGAAACCCTTCGGAAG  
Rv: ATAGTCCACAGACGGTACGCGGG 97