Skip to main content

Table 1 Primers used in all experiments

From: Structural and functional characterization of a novel gene, Hc-daf-22, from the strongylid nematode Haemonchus contortus

Primer ID and direction Primer sequence 5′–3′
Hc-daf-22 1F TACAGACAGTGCCCGGCCATCA
Hc-daf-22 1R GGCAGTAATAGGGGCAGGGAACA
Hc-daf-22 2F GCTTCTGGCTCTTCTGGGCTCTACT
Hc-daf-22 2R GAAAGCGGTAACTCTGACGTTGTGCTTGC
Hc-daf-22 F1 ATGGGTAAATCAAAAGTATATG
Hc-daf-22 R1 ACTGAGTGCAGATGGTT
Hc-daf-22 F2 ACGCCGGCAAAGAACATAT
Hc-daf-22 R2 CCCTTACCGACGTCACACACAAT
Hc-daf-22 F3 ACTTATGAGGCTCTGGGATTG
Hc-daf-22 R3 GCATCGATAGTCCACTTCTTTAC
Hc-daf-22 F4 AGGAAAATGGGTGATCAATCCGTCT
Hc-daf-22 R4 TCAGATTTTCGCTTTGAGCATTTTC
Hc-daf-22-SP1 GATAGGTATGCCAGTGAACCCGAGT
Hc-daf-22-SP2 GCAATCGTCCAACGCCATATTCACT
Hc-daf-22-SP3 AATACACTCACCGGCTTCCTTCACC
Hc-daf-22 RT F GTATATGTGATTGGTGTCGG
Hc-daf-22 RT R AATATCCGACGGTAGCTT
tub-F TGTTCCATCACCCAAGGTATCC
tub-R TGACAGACACAAGGTGGTTGAGAT
Hc-daf-22PF AACTGCAGGATTGGTCGAGAGAGATGAAAC
Hc-daf-22PR CGGGATCCGATGGTCCGGGCTGCAATAAATT
Hc-daf-22dF TCCCCCGGGATGGGTAAATCAAAAGTATATG
Hc-daf-22dR GGGGTACCCAGATTTTCGCTTTGAGCAT
Ce-PF GCGCTCTAGATTAATTCAATGCACAACTC
Ce-PR TCCCCCGGGTTTCTGGAACAATATT
RNAi F CCCAAGCTTGTGAACAATGCCTGCCTGCGCTT
RNAi R CTAGCTAGCCCTGTCGCACCGATGGG