Skip to main content

Table 2 Primers and PCR conditions

From: Identification of a novel β-adrenergic octopamine receptor-like gene (βAOR-like) and increased ATP-binding cassette B10 (ABCB10) expression in a Rhipicephalus microplus cell line derived from acaricide-resistant ticks

Oligo name Sequence (5′-3′) AT Amplicon Accession No. Positions Reference
βAOR-For GAAATCTGACGGACGAGGAA 61 °C (Rm) 183 bp JN974909 95–277 [15]
βAOR-Rev GCGACACGATGAAGTAGTTG 58 °C (Rhipi)
ABCB10-For GCCGCAGTTGTCACTTGTTGGTTTG 61 °C 96 bp JN098446 887–982 [17]
ABCB10-Rev ACGTCCGCTGCCACTTGCCTC
ActBm1-For GAGGAAGTACTCCGTCTGGATCGG 61 °C 203 bp AY255624 1095–1297 [42]
ActBm1-Rev CCGTAGGGTGGCGTTGCCGG
  1. Abbreviations: AT annealing temperature, bp base pair, Rm Rhipicephalus microplus, Rhipi other Rhipicephalus species