Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Genes and primers used in Q-PCR validation

From: Transcriptomic analysis of mouse liver reveals a potential hepato-enteric pathogenic mechanism in acute Toxoplasma gondii infection

Gene Accession No. Primer name Primer sequence (5′ to 3′) Product length (bp)
Fbln5 NM_011812.4 Fbln5-F1 TAGAGCTCAAGGCTAGAAG 94
Car3 NM_007606.3 Car3-F1 CAGCCCTGGTCAGCATCT 145
Cyp2c69 NM_001104525.1 Cyp2c69-F1 CTGAGAAAGGCACGAAGT 232
Atp6v0a4 NM_080467.3 Atp6v0a4-F1 ATTCTCAGCCTCTTCAATCA 195
Gbp2b NM_010259.2 Gbp2b-F AAATGGCCTCAGAAATCCAC 107
Serpina6 NM_007618.3 Serpina6-F1 ACACCACCAAAGACACTCC 193
β-actin NM_007393.5 β-actin-F1 GCTTCTAGGCGGACTGTTAC 100
  1. Forward (F1) and reverse (R1) primers used for quantitative PCR