Skip to main content

Table 1 Genes and primers used in Q-PCR validation

From: Transcriptomic analysis of mouse liver reveals a potential hepato-enteric pathogenic mechanism in acute Toxoplasma gondii infection

Gene Accession No. Primer name Primer sequence (5′ to 3′) Product length (bp)
Fbln5 NM_011812.4 Fbln5-F1 TAGAGCTCAAGGCTAGAAG 94
   Fbln5-R1 ACTTAGCGTCTCTACTCTG
Car3 NM_007606.3 Car3-F1 CAGCCCTGGTCAGCATCT 145
   Car3-R1 ATTGGCGAAGTCGGTAGG
Cyp2c69 NM_001104525.1 Cyp2c69-F1 CTGAGAAAGGCACGAAGT 232
   Cyp2c69-R1 GAATGAGGTCCAACGATA
Atp6v0a4 NM_080467.3 Atp6v0a4-F1 ATTCTCAGCCTCTTCAATCA 195
   Atp6v0a4-R1 CAGAAACATGCCGATAAAGT
Gbp2b NM_010259.2 Gbp2b-F AAATGGCCTCAGAAATCCAC 107
   Gbp2b-R1 TTGGATAGCAGACAGGATGT
Maoa NM_173740.3 Maoa-F1 AGATTTCTAAGCCTACCTGT 136
   Maoa-R1 GAGCCCTAATTTCATTCTGT
Serpina6 NM_007618.3 Serpina6-F1 ACACCACCAAAGACACTCC 193
   Serpina6-R1 ATCATCAGGCTGCTCCAT
Ifng NM_008337.4 Ifng-F1 CCTGAAAGAAAGCAGTGTCT 85
   Ifng-R1 TTTGTCATTCGGGTGTAGTC
Il1b NM_008361.4 Il1b-F1 ACAGTGATGAGAATGACCTG 332
   Il1b-R1 GTAGTGCAGTTGTCTAATGG
Cat NM_009804.2 Cat-F1 GCAGTGATTTCACATAGGAT 131
   Cat-R1 GAGAGCTGGTAATCTCTACT
β-actin NM_007393.5 β-actin-F1 GCTTCTAGGCGGACTGTTAC 100
   β-actin-R1 CCATGCCAATGTTGTCTCTT
  1. Forward (F1) and reverse (R1) primers used for quantitative PCR