Skip to main content

Table 1 List of oligonucleotides

From: Stimulation and quantification of Babesia divergens gametocytogenesis

Gene name and sequence reference Sequencing primers qRT-PCR primers
Sequence 5′-3′ and amplicon length (bp) Sequence 5′-3′ and amplicon length (bp)
gapdh
(LK934710)
F: TTGACTGTCGATGGTGCTTC 391 F: TACTTACGAGCAGATCGTTGC 140
R: ACCATGACACAAGCTTCACG R: CGGCCTTGACATCGAAAATG
actin
(LK934710)
F: GCTTTGTTACATTGCCCTCG 437 F: GTCAGCGTATGACGAAGGAG 131
R: CCTCCTTGGTGATCCACATC R: CTGGAAGGTGGAAAGGGATG
b-tubulin
(LK934711)
F: TTCCCCAGACTGCACTTCTT 400 F: GAGTGGATCCCACACAACAC 138
R: TGTGTACCAGTGAAGGAAGG R: CATTGCTGTGAATTGCTCCG
18S
(FJ944825)
F: ATGCCTAGTATGCGCAAGTC 131
R: AAGCCGACGAATCGGAAAG
bdccp1
(FJ943575)
F: GATCGTTCCTCGCTAGCCTAT 639 F: CGCATGCCAGAAAAACAACC 132
R: TGCACTGATTTACGCAGCTC R: GCGTCTTTCAGACATCCTCG
bdccp2
(FJ943576)
F: GCGGGAGAACATGTAGGATG 701 F: CTGTGAGGCCAACTACTGTG 135
R: TTCGCAACACAGCTCACAAT R: AAGTGGTCCACGGTTTTCTG
bdccp3
(FJ943577)
F: CCCACCTCCTTTGACTTCAG
R: GTGCATCTTGAGCACGAAAA
780 F: GTTGTGGTAAAAGCTGCATGG
R: AGAATCGTGACAACTGCCTC
139