Skip to main content

Table 1 Primer names, targets, sequences and amplicon sizes for PCR detection of African trypanosomes

From: Eco-epidemiology of porcine trypanosomosis in Karim Lamido, Nigeria: prevalence, seasonal distribution, tsetse density and infection rates

Primer [Reference] Target species Target gene Sequence (5'-3') Amplicon size (bp)
TBR1 [44] Trypanozoon 177 bp repeat cgaatgaatattaaacaatgcgcagt 173
TBR2 [44]   Sequence agaaccatttattagctttgttgc  
TCK1 [45] T. c. kilifi SDNAm gtgcccaaatttgaagtgat 294
TCK2 [45]    actcaaaatcgtgcacctcg  
TCF1 [45] T. c. forest SDNAm ggacacgccagaaggtactt 350
TCF2 [45]    gttctcgcaccaaatccaac  
TCS1 [45] T. c. savannah SDNAm cgagaacgggcactttgcga 316
TCS2 [45]    ggacaaagaaatcccgcaca  
TVWI [46] T. vivax ILDat 1.2 gtgctccatgtgccacgttg 175
TVW2 [46]    catatggtctgggagcgggt  
TeRoTat 920 F [47] T. evansi RoTat 1.2 ctgaagaggttggaaatggagaag 151
TeRoTat 1070R [47]   VSG gene gtttcggtggttctgttgttgtta  
TgsGP-F [48] T. brucei TgsGP gctgctgtgttcggagagc 308
TgsGP-R [48] gambiense   gccatcgtgcttgccgctc  
SRA-F [49] T. brucei SRA atagtgacaagatgcgtactcaacgc 284
SRA-R [49] rhodesiense   aatgtgttcgagtacttcggtcacgct