Skip to main content

Table 1 List of primers and probe for the lateral-flow stripe, real-time RPA assay and qPCR based on the Schistosoma japonicum genomic DNA

From: Recombinase polymerase amplification combined with a lateral flow dipstick for rapid and visual detection of Schistosoma japonicum

Assay format Name Sequence 5′–3′
Lateral-flow stripe RPA RF CCCAAGTCTCAGTGAAGTTGTGAAGGCTAT
RR Biotin-GTTAGTGTTCGAGACCAGTCAGATGGGATT
Probe FAM-CTTAAAGCGAGGGAGAGCGGCAGGACCAG
ATG[THF]ATTGACCCCTGAGATAT-ph
Real- time RPA RF CCCAAGTCTCAGTGAAGTTGTGAAGGCTAT
RR GTTAGTGTTCGAGACCAGTCAGATGGGATT
Probe CTTAAAGCGAGGGAGAGCGGCAGGACCAGA
[FAM-dT]G[THF]A[BHQ-dT]TGACCCCTGAGATAT-/C3-spacer/
qPCR RF GACAGGTTCTGGAACATAGG
RR GGTCAATTCCGAAGACAATC
  1. Abbreviations: FAM 6-Carboxyfluorescein, THF tetrahydrofuran, BHQ black hole quencher