Skip to main content

Table 1 Gene-specific primers used in this study

From: 2-Cys peroxiredoxin is required in successful blood-feeding, reproduction, and antioxidant response in the hard tick Haemaphysalis longicornis

Primer Sequence (5'–3')
HlPrx2 RT-F TATGCCTAAGCTGGCGAAGC
HlPrx2 RT-R CAGGCGAGGTGAGAGAAGTG
HlPrx RT-F ATGAGGTCCTCCGTGCTACT
HlPrx RT-R TGCCACACCGTCATAAGCAT
HlPrx2 real time-F GTGTGCCCTGCTAACTGGAA
HlPrx2 real time-R ATGAGACACACGGGGCTTTG
HlPrx2 T7-F TAATACGACTCACTATAGG GATCAAGCTGTCCGATTACAAGAAC
HlPrx2 T7-R TAATACGACTCACTATAGG TTCCAGTTAGCAGGGCACACT
HlPrx2 RNAi-F GATCAAGCTGTCCGATTACAAGAAC
HlPrx2 RNAi-R TTCCAGTTAGCAGGGCACACT
HlPrx T7-F TAATACGACTCACTATAGG CACCACGGTTGGATCAAGGA
HlPrx T7-R TAATACGACTCACTATAGG TTTGCAGAGCCACCACTCAA
HlPrx RNAi-F CACCACGGTTGGATCAAGGA
HlPrx RNAi-R TTTGCAGAGCCACCACTCAA
Actin RT-F CCAACAGGGAGAAGATGACG
Actin RT-R ACAGGTCCTTACGGATGTCC
Actin real time-F ATCCTGCGTCTCGACTTGG
Actin real time-R GCCGTGGTGGTGAAAGAGTAG
Tubulin real time-F TTCAGGGGCCGTATGAGTAT
Tubulin real time-R TGTTGCAGACATCTTGAGGC
P0 real time-F CTCCATTGTCAACGGTCTCA
P0 real time-R TCAGCCTCCTTGAAGGTGAT
L23 real time-F CACACTCGTGTTCATCGTCC
L23 real time-R ATGAGTGTGTTCACGTTGGC
  1. Italics denote T7 RNA polymerase promoter sequences