Skip to main content

Table 1 Primers used in the study, annealing temperatures used in the PCRs and expected sizes of the PCR products

From: Occurrence and multilocus genotyping of Giardia intestinalis assemblage C and D in farmed raccoon dogs, Nyctereutes procyonoides, in China

Gene Primer Sequence (5′–3′) Annealing temperature (°C) Fragment length (bp) Reference
tpi F1 AAATIATGCCTGCTCGTCG 55 530 [3]
R1 CAAACCTTITCCGCAAACC
F2 CCCTTCATCGGIGGTAACTT 55
R2 GTGGCCACCACICCCGTGCC
gdh F1 TTCCGTRTYCAGTACAACTC 50 530 [3]
R1 ACCTCGTTCTGRGTGGCGCA
F2 ATGACYGAGCTYCAGAGGCACGT 65
R2 GTGGCGCARGGCATGATGCA
bg F1 AAGCCCGACGACCTCACCCGCAGTGC 50 511 [3]
R1 GAGGCCGCCCTGGATCTTCGAGACGAC
F2 GAACGAACGAGATCGAGGTCCG 60
R2 CTCGACGAGCTTCGTGTT