Skip to main content

Table 1 Primer sequences used to amplify the GNBPB2 gene (NCBI Probe database accession number: Pr032290638)

From: Molecular evolution and population genetics of a Gram-negative binding protein gene in the malaria vector Anopheles gambiae (sensu lato)

PCR reaction Primer Sequence 5′-3′ Product size (bp)
1 GNBPB2-out-F CACTCCAGCGAACATTTGTG 1902
GNBPB2-out-R CTTCAGTGTGTGGCGGTTTA
2 GNBPB2-in-3-F CCCTAAATAAAGCGGCACAC 851
GNBPB2-in-3-R GCACTCTTGATGGGGTTGAT
3 GNBPB2-in-5-F GTTCTGGGGATGTGAGCGTA 963
GNBPB2-in-5-R CAGGGATCTTTTGCGTGATT
4 GNBPB2-centre-F ACRGGAGAGCTGATCTTTGA 571
GNBPB2-centre -R GCCWCGRTAGTCCATATTGC