Skip to main content

Table 1 The eight microsatellite loci used to examine genetic diversity in a sand fly Lutzomyia vexator at a site in northern California, the University of California Hopland Research and Extension Center. For each locus, the GenBank accession numbers, motif, length (in nucleotides) of expected amplicon at given repeat length and PCR primers are presented

From: Genetic differentiation over a small spatial scale of the sand fly Lutzomyia vexator (Diptera: Psychodidae)

Locus GenBank Motif Length Primers (5′–3′)
Lvx9 KT693036 AG 172 (19×) F: CCGAATTGTCGAACGATTTG
R: GTCAATTTGATGCTCTCGTAC
Lvx67 KT693037 AG 165 (18×) F: CCAAGAATCGCATATCAACATG
R: GCTTCATCCTGTATTCATGG
Lvx123 KT693038 TC 318 (22×) F: CCTTATTCTCACTTGCATCTCGG
R: AGAGAAGATAGAGCTCCATTGGG
Lvx179 KT693039 CT 296 (22×) F: CGCAAACATGCTGATAAAGAATGC
R: GGACTTTGTTGCATTGCAGC
Lvx7442 KT693040 AG 323 (19×) F: GCTTCCAAAGAGGAAGGTGAG
R: GGATACACTCGAAAATTGGTGC
Lvx504 KT693041 TC 403 (25×) F: GTTCTTTAAGACGCGTGAAATGC
R: AAATTCTCATTGGGCAGGATAGC
Lvx90606 KT693042 CTT 246 (12×) F: GTCTCAATACGCGTCTCTCAAAG
R: GTTAGTGCGAGAGGCAGAGTC
Lvx918 KT693043 AG 301 (15×) F: GGTTGAACAACAGTCAGCTAAG
R: GCCTAAAGGAAACGTAGCATTCTC
  1. Abbreviations: F forward, R reverse