Skip to main content

Table 1 Primers and amplification conditions utilized in the current study for the identification and quantification of Legionella spp., Acanthamoeba spp., Naegleria fowleri and Vermamoeba (Hartmannella) vermiformis in pasteurized and unpasteurized tank water samples

From: Molecular detection of Acanthamoeba spp., Naegleria fowleri and Vermamoeba (Hartmannella) vermiformis as vectors for Legionella spp. in untreated and solar pasteurized harvested rainwater

Organism Primer name Primer sequence (5'–3') Gene (size, bp) Amplification conditions Reference
Legionella spp. (Identification) LEG 225 AAGATTAGCCTGCGTCCGAT 16S rRNA (634) 95 °C (1.5 min) followed by 30 cycles of 94 °C (10 s), 64 °C (1 min) and 74 °C (1 min). Final extension: 72 °C (10 min). Miyamoto et al. [57]
LEG 858 GTCAACTTATCGCGTTTGCT
Legionella spp. Leg F CTAATTGGCTGATTGTCTTGAC 23S-5S rRNA (259) 95 °C (1 min) followed by 45 cycles of 95 °C (15 s), 60 °C (15 s) and 72 °C (11 s) Herpers et al. [58]
Leg R CAATCGGAGTTCTTCGTG
Acanthamoeba spp. AcantF900 CCCAGATCGTTTACCGTGAA 18S rDNA (±180) 95 °C (1 min) followed by 45 cycles of 95 °C (15 s), 60 °C (1 min) and 72 °C (40 s) Qvarnstrom et al. [59]
AcantR1100 TAAATATTAATGCCCCCAACTATCC
Naegleria fowleri NaeglF192 GTGCTGAAACCTAGCTATTGTAACTCAGT 18S rDNA (153) 95 °C (1 min) followed by 45 cycles of 95 °C (15 s), 64 °C (1 min) and 72 °C (1 min) Qvarnstrom et al. [59]
NaeglR344 CACTAGAAAAAGCAAACCTGAAAGG
Vermamoeba (Hartmannella) vermiformis Hv1227F TTACGAGGTCAGGACACTGT 18S rRNA (502) 95 °C (3 min) followed by 45 cycles of 95 °C (20 s), 58 °C (30 s) and 72 °C (40 s) Kuiper et al. [60]
Hv1728R GACCATCCGGAGTTCTCG