Skip to main content

Table 1 Primers used for RT-PCR of GPCR genes in S. mansoni

From: GPCR and IR genes in Schistosoma mansoni miracidia

Gene ID Forward Reverse bp
Smp_170020 GAGATGACTATAAGCG CAAGTCTGGTTGTATG 303
Smp_120620 CGATGCGATAAAGATG CTGTTAGTGTTGGATG 471
Smp_141880 TGTTAGGATGTTAGTGG GGTTTTAGGTTGCTTG 345
Smp_104210 GGCTTGTGAGCTGTATGG GATGTATGAAAACCTTCGGG 321
Smp_178420 ACATACCTACACCACTTCTTC TTTGTGTTGTGCAATCGC 218
Smp_180030 ATCAATACTGGCCATGGG CATAACGTCCAAAACCAAAG 230
Smp_041880 TGATTTTCTTGGACGTGG GCTGGTAATAAAGCTGTTC 478
Smp_148210 TTGGTGAAGGTATGTGTG CAGCATGTGCCATATTAC 365
Smp_043260 AAAGGCGAATTGGAAAC CAATCACATATAGCTTCACC 387
Smp_149580 CGTTTAGTTGTATGCTGTTG TTGGGTTGGTTGTAATGG 281
Smp_118040 GGCCTAAAGAATCATCAC GTACATCCATAACCATCC 275
Smp_204230 CACGTAATTGGTCTGTTG CACATATAACTGGACCAC 294
Smp_126730 AGTGAATTGTCCAGAGAAG GTAGACCGTATTGAGCAG 358
Smp_173010 GCTGTATTTCGTGTTCTC GTAGGATTTTGTGGATTGG 392
Smp_203500 GTAATTTGTGTTCCGTCC TGTCGATTATCTCTTGCG 383
Smp_043320 CTCCCTCCAAATCCTATC ATTATCCAAGCACCTCCA 371
Smp_145520 ATGATTGGAGGTGCTTGG GTGTGTTAGAATGCTTCGG 303
tubulin GGCGGTGGTACTGGTTCTGGG CATTTAGCGCACCATCGAAGC 324