Skip to main content

Table 1 Primers used in this study

From: Anaplasma marginale and A. phagocytophilum in cattle in Tunisia

Species Target gene Primer Sequence 5’–3’ Reference
A. marginale msp4 M4-OvMar-F ATCTTTCGACGGCGCTGTG This study
M4-Mar-R ATGTCCTTGTAAGACTCATCAAATAGC
A. phagocytophilum msp2 Msp2-3 F CCAGCGTTTAGCAAGATAAGAG [30]
Msp2-3R GCCCAGTAACAACATCATAAGC