Skip to main content

Table 2 List of identified miRNAs associated with S. japonicum egg EVs

From: Release of extracellular vesicles containing small RNAs from the eggs of Schistosoma japonicum

Small RNA ID Location Sequence Readsa miRNA
t0000052 SJC_S000027 600247 600269 CCACCGGGTAGACATTCATTCGC 29608 sja-miR-36-3p
t0000207 SJC_S000052 314799 314820 + AACCCTGTAGACCCGAGTTTGG 6156 sja-miR-10-3p
t0000525 SJC_S000254 288019 288040 + TGAGATCGCGATTAAAGCTGGT 2307 sja-bantam
t0000729 SJC_S000054 245452 245472 TCACAGCCAGTATTGATGAAC 1332 sja-miR-2a-3p
t0000925 SJC_S000054 245576 245597 TGAAAGACGATGGTAGTGAGAT 1085 sja-miR-71a
t0001363 SJC_S000055 384663 384684 TATTGCACTTACCTTCGCCTTG 1070 sja-miR-3479-3p
t0001942 SJC_S000471 22294 22314 TATTATGCAACGTTTCACTCT 1038 sja-miR-2162-3p
t0001985 SJC_S000102 364277 364299 + AAAGACTTGAGTAGTGAGACGCT 746 sja-miR-71b-3p
t0002533 SJC_S000054 245393 245413 CGTCTCAAAGGACTGTGAGCC 585 sja-miR-2b-3p
t0002630 SJC_S000664 24730 24752 + TGACTAGAAAGTGCACTCACTTC 570 sja-miR-61
t0003175 SJC_S000001 925810 925830 TAAATGCATTTTCTGGCCCGT 554 sja-miR-277
t0003502 SJC_S004031 7481 7503 + TCACAACCTACTTGATTGAGGGG 238 sja-miR-307
t0005635 SJC_S000102 364554 364577 + TATCACAGTCCTGCTTAGGTGACG 139 sja-miR-2d-3p
t0007134 SJC_S000110 287436 287456 GGCCTCGTGGTGTAGCGGTTATC 105 novel-miR-7
  1. aOnly miRNAs with > 100 reads are listed