Skip to main content

Table 1 Primers used during this study

From: Novel Rickettsia raoultii strain isolated and propagated from Austrian Dermacentor reticulatus ticks

Name Sequence (5′-3′) Annealing temperature (°C) Target Reference
Rick-F1 GAACGCTATCGGTATGCTTAACACA 67–57a 16S ribosomal RNA gene [23]
Rick-R2 CATCACTCACTCGGTATTGCTGGA
RCK/23-5-F GATAGGTCRGRTGTGGAAGCAC 65–55a 23S–5S ribosomal RNA intergenic spacer [29]
RCK/23-5-R TCGGGAYGGGATCGTGTGTTTC
D1f ATGAGTAAAGACGGTAACCT 60 sca4 [37]
D928r AAGCTATTGCGTCATCTCCG
190-70 ATGGCGAATATTTCTCCAAAA 60 ompA [38]
190-701 GTTCCGTTAATGGCAGCATCT
120-2788 AAACAATAATCAAGGTACTGT 60 ompB [39]
120-3599 TACTTCCGGTTACAGCAAAGT
CS-78 GCAAGTATCGGTGAGGATGTAAT 60 gltA [40]
CS-323 GCTTCCTTAAAATTCAATAAATCAGGAT
  1. a Touch down PCR protocol decreasing annealing temperature by 1 °C per cycle during the first 10 cycles