Skip to main content

Advertisement

Table 1 Primers and PCR amplification conditions

From: Anaplasma phagocytophilum in sheep and goats in central and southeastern China

Target gene Primer name Primer sequence (5’-3’) Annealing temperature (°C) Amplicon size (bp) Reference
16S rRNA EE-1 TCCTGGCTCAGAACGAACGCTGGCGGC 55 1433 [17, 18]
EE-2 AGTCACTGACCCAACCTTAAATGGCTG    
SSAP2f GCTGAATGTGGGGATAATTTAT 55 641  
SSAP2r ATGGCTGCTTCCTTTCGGTTA    
groEL EphplgroEL(569)F ATGGTATGCAGTTTGATCGC 62 624 [19]
EphplgroEL(1193)R TCTACTCTGTCTTTGCGTTC    
EphplgroEL(569)F ATGGTATGCAGTTTGATCGC 56 573  
EphgroEL(1142)R TTGAGTACAGCAACACCACCGGAA