Skip to main content

Advertisement

Table 1 Primer sequences of target genes used in the study

From: Anisakis pegreffii (Nematoda: Anisakidae) products modulate oxidative stress and apoptosis-related biomarkers in human cell lines

Gene Primer (5′–3′) Annealing temperature (°C) Accession number
c-jun F: GGATCAAGGCGGAGAGGAA 69 NC_018912.2
R: TCCAGCCGGGCGATT
c-fos F: TCACCCGCAGACTCCTTCTC 71.5 NC_018925.2
R: GTGGGAATGAAGTTGGCACTG
p53 F: AAGAAACCACTGGATGGAGAA 69 NC_018928.2
R: CAGCTCTCGGAACATCTCGAAA
β-actin F: AGGCTGTGCTGTCCCTGTAT 70 NC_018928.2
R: ACCCAAGAAGGAAGGCTGGA
GADPH F: ACCCACTCCTCCACCTTTGAC 72 NC_018923.2
R: GTCCACCACCCTGTTGCTGTA
  1. Abbreviations: F forward primer, R reverse primer