Skip to main content

Table 1 Primer sequences of target genes used in the study

From: Anisakis pegreffii (Nematoda: Anisakidae) products modulate oxidative stress and apoptosis-related biomarkers in human cell lines

Gene Primer (5′–3′) Annealing temperature (°C) Accession number
c-fos F: TCACCCGCAGACTCCTTCTC 71.5 NC_018925.2
β-actin F: AGGCTGTGCTGTCCCTGTAT 70 NC_018928.2
  1. Abbreviations: F forward primer, R reverse primer