Skip to main content

Table 1 Primers used in the study, annealing temperatures used in the PCRs and expected sizes of the PCR products

From: The presence of Giardia intestinalis in donkeys, Equus asinus, in China

Gene Primer Sequence (5'-3') Annealing temperature (°C) Fragment length (bp) Reference
tpi F1 AAATIATGCCTGCTCGTCG 55 530 [24]
R1 CAAACCTTITCCGCAAACC
F2 CCCTTCATCGGIGGTAACTT 55
R2 GTGGCCACCACICCCGTGCC
gdh F1 TTCCGTRTYCAGTACAACTC 50 530 [24]
R1 ACCTCGTTCTGRGTGGCGCA
F2 ATGACYGAGCTYCAGAGGCACGT 65
R2 GTGGCGCARGGCATGATGCA
bg F1 AAGCCCGACGACCTCACCCGCAGTGC 50 511 [24]
R1 GAGGCCGCCCTGGATCTTCGAGACGAC
F2 GAACGAACGAGATCGAGGTCCG 60
R2 CTCGACGAGCTTCGTGTT