Molecular detection of Rickettsia species in ticks collected from the southwestern provinces of the Republic of Korea

Table 2 Primer sequences and nested PCR conditions for detection of rickettsial target genes from ticks collected from four southwestern provinces of Chungcheongnam, Chungcheongbuk, Jeollanam, and Jeollabuk in the Republic of Korea

Target gene	Primer name	Nucleotide sequence (5'–3')	Product size (bp)	PCR profile (°C/s)				Reference
Target gene	Primer name	Nucleotide sequence (5'–3')	Product size (bp)	Denaturation	Annealing	Extension	Cycles	Reference
17 kDa	Rr17k. 1p	TTTACAAAATTCTAAAAACCAT	539	95/30	57/60	72/120	35	[23]
	Rr17k. 539n	TCAATTCACAACTTGCCATT	539	95/30	57/60	72/120	35
	Rr17k. 90p	GCTCTTGCAACTTCTATGTT	450	95/30	57/60	72/120	35
	Rr17k. 539n	TCAATTCACAACTTGCCATT	450	95/30	57/60	72/120	35
ompA	Rr190k. 71p	TGGCGAATATTTCTCCAAAA	650	95/30	42/35	60/120	35	[23]
	Rr190k. 720n	TGCATTTGTATTACCTATTGT	650	95/30	42/35	60/120	35
	Rr190k. 71p	TGGCGAATATTTCTCCAAAA	532	95/30	48/60	65/120	35
	Rr190k. 602n	AGTGCAGCATTCGCTCCCCCT	532	95/30	48/60	65/120	35

ISSN: 1756-3305