Skip to main content

Table 2 Primer sequences and nested PCR conditions for detection of rickettsial target genes from ticks collected from four southwestern provinces of Chungcheongnam, Chungcheongbuk, Jeollanam, and Jeollabuk in the Republic of Korea

From: Molecular detection of Rickettsia species in ticks collected from the southwestern provinces of the Republic of Korea

Target gene Primer name Nucleotide sequence (5'–3') Product size (bp) PCR profile (°C/s) Reference
Denaturation Annealing Extension Cycles
17 kDa Rr17k. 1p TTTACAAAATTCTAAAAACCAT 539 95/30 57/60 72/120 35 [23]
Rr17k. 539n TCAATTCACAACTTGCCATT
Rr17k. 90p GCTCTTGCAACTTCTATGTT 450 95/30 57/60 72/120 35
Rr17k. 539n TCAATTCACAACTTGCCATT
ompA Rr190k. 71p TGGCGAATATTTCTCCAAAA 650 95/30 42/35 60/120 35 [23]
Rr190k. 720n TGCATTTGTATTACCTATTGT
Rr190k. 71p TGGCGAATATTTCTCCAAAA 532 95/30 48/60 65/120 35
Rr190k. 602n AGTGCAGCATTCGCTCCCCCT
\