Skip to main content

Table 1 The siRNA sequences used for RNAi studies

From: RNA interference mediated knockdown of Brugia malayi UDP-Galactopyranose mutase severely affects parasite viability, embryogenesis and in vivo development of infective larvae

  siRNA Sequence (5'–3')
Targeting bmugm siRNA1 sense CAGUAUUAGUGAAGAAGAAUU
anti-sense UUGUCAUAAUCACUUCUUCUU
siRNA2 sense GGAAAUAUGAGGUAUCAAAUU
anti-sense UUCCUUUAUACUCCAUAGUUU
Non-targeting scrambled (negative control) sense UAGCGACUAAACACAUCAAUU
anti-sense UUAUCGCUGAUUUGUGUAGUUUU