Skip to main content

Table 2 The primers sequences used for real time RT-PCR analysis

From: RNA interference mediated knockdown of Brugia malayi UDP-Galactopyranose mutase severely affects parasite viability, embryogenesis and in vivo development of infective larvae

Real time qPCR primers Sequence (5'–3')
bmugm sense CACCTGGTGGATTAAGTCGAACAG
anti-sense AGATGCAAGCCTTTCTCGTTGAAC
β-tubulin sense ACTTGGTGTCCGAATATC
anti-sense ACTCTTCCTGTTCAATGTAT