Skip to main content

Table 2 Primers for amplification and sequencing of the ribosomal transcription unit

From: The ribosomal transcription units of Haplorchis pumilio and H. taichui and the use of 28S rDNA sequences for phylogenetic identification of common heterophyids in Vietnam

Primer name Sequence (5'–3') Length (bp) Tm (°C) Target gene Reference
UD18SF AACCTGGTTGATCCTGCCAG 20 59 18S (F) [15]
NS1F GTAGTCATATGCTTGTCTC 19 48 18S (F) This study
U18SF GCGAATGGCTCATTAAATCAGC 22 57 18S (F) This study
U18S2Ra GGTTCTGTTCTAATAAATCCAC 22 50 18S (R) This study
U18SARa CCGTCGCCGACACAAGGCCGAC 22 67 18S (R) This study
NS2Fa GCAAGTCTGGTGCCAGCAGCC 21 66 18S (F) This study
NS2Ra GGCCTGCTTTGAGCACTC 18 59 18S (R) This study
U18S2F TCGTGACTGGGATCGGGGC 19 64 18S (F) This study
NS5Fa TGAATGGTTTAGCAAGGTCCTCGG 24 61 18S (F) This study
U18SRa GGAACCAATCCGAGGACCTTGC 22 63 18S (R) This study
NS8Ra CACCTACGGAAACCTTGTTACGACTT 26 60 18S (R) This study
U3SF GGTACCGGTGGATCACTCGGCTCGTG 26 67 5.8S (F) This study
U3SR CGACCCTCGGACAGGCG 17 64 5.8S (R) This study
U28SFa CTAACAAGGATTCCCTTAGTAAC 23 52 28S (F) This study
U28S2Ra ACAACCCGACTCCAAGGTC 19 59 28S (R) This study
U28Fa TCGGAGACGGCGGCTTG 17 63 28S (F) This study
U28S2Fa ATCACCGGCCCGTCCCATG 19 65 28S (F) This study
U28SR GTCTTTCGCCCCTATACTCAC 21 57 28S (R) This study
1500R GCTATCCTGAGGGAAACTTCG 21 57 28S (R) [15]
  1. Abbreviations F forward, R reverse, Tm melting temperature
  2. aPrimers used for sequencing