Skip to main content

Table 2 The sequences of GSPs for multiplex asymmetric RT-PCR and PCR amplification

From: Ultra-sensitive chemiluminescence imaging DNA hybridization method in the detection of mosquito-borne viruses and parasites

Pathogen Primer Sequence (5′ to 3′) Location Referencea Primer source
Dengue virus DC10418 TTGAGTAAACYRTGCTGCCTGTAGCTC 10,392–10,481 GQ398257 [21]
JEV JEV-3UTR–F2 GGACTGGGTTAACAAATCTG 10,525–10,544 EF107523 Present study
YFV YEF-3UTR-F1 AAACTACGGATGGAGAACCG 10,489–10,508 U54798 Present study
WNV WNV-3UTR-F2 AAGTTGAGTAGACGGTGCTGC 10,533–10,553 EU249803 Present study
SLEV SLE-3UTR-F1 GGATGTCAGGTAAACGGTGCT 10,451–10,471 FJ753286 Present study
Flavivirus CDC10564b GGGTCTCCTCTAACCTCTAGTCCT 10,569–10,592 GQ398257 [21]
EEEV EEE-E1-F ACACTAAATTCACCCTAGTTCGAT 11,376–11,399 AY705241 [22]
EEE-1-Rb GTGTATAAAATTACTTAGGAGCAGCATTATG 11,492–11,522 AY705241
CHIKV CHIKV-F1 TGGATGAACATGGAAGTGAA 7,121–7,140 DQ443544 Present study
CHIKV-R2b GCTGTAGTGCGTACCTATTT 7,496–7,515 DQ443544 Present study
WEEV WEE-F AGGGATACCCCCGAAGGTT 8,220–8,238 AF214040 [23]
WEE-Rb GTGAATAGCACACGGGTGGTT 8,302–8,322 AF214040
VEEV VEEV-cap-F3 GGGCGGCGCATGAGAGAAGC 3–22 U34999 Present study
VEEV-cap-R3b GTGACCTGCTTGGCTTCTACCTC 119–141 U34999 Present study
Plasmodium MAL-F1 GGGAGTGAAGACGATCAGATACC 443–465 HQ283215 Present study
MAL-R1b CCGTGTTGAGTCAAATTAAGCC 668–689 HQ283215 Present study
W. bancrofti BM/WBF AGCGTGATGGCATCAAAGTAG 1–21 L20344 [24]
WBRb AGGTTATACCAAGCAAACAAAAA 110–132 L20344
B. malayi/ B. timori MGB-HhaI-For GCAATATACGACCAGCAC 254–271 M12691 [25]
MGB-HhaI-Revb ACATTAGACAAGGAAATTGGTT 140–161 M12691
  1. aGenBank accession numbers
  2. bThese primers were labeled by biotin to give off CL signals