Skip to main content

Table 3 Capture probe sequences for DNA hybridization

From: Ultra-sensitive chemiluminescence imaging DNA hybridization method in the detection of mosquito-borne viruses and parasites

Pathogen Capture probe Sequence (5′ to 3′)a Location Referenceb
DENV DEN-10731c GGGAGGCCATGCGCCATGGAAGCTGTACGCATGGTGTAGCAGACT 10,443–10,487 GQ398257
DENV-1 DEN1-X10830 GCCCAACACCAGGGGAAG 10,520–10,537 FJ687426
DENV-2 DEN2-X10831 GCCCAAGGYGAGATGAAGCT 10,535–10,554 GQ398257
DENV-3 DEN3-X10829 GGCCCGAGCACTGAGGGAAGC 10,507–10,527 FJ898444
DENV-4 DEN4-X10714 CGTAATAATCCCTAGGGAGGCC 10,380–10,401 EF457906
JEV JEV-10726 CCCACGGCCCAAGCCTCGTCTAGGAT 10,703–10,728 EF107523
YFV YFV-10679 CCTCCGCTACCACCCTCCCAC 10,667–10,687 U54798
WNV WNV-10768 AACTTCAAAGCCCAATGTCAGACCACG 10,650–10,676 EU249803
SLEV SLE-10553 GTGCAAAGCCCCTCATTCCGACTCG 10,522–10,546 FJ753286
EEEV EEEV-11424 GTTCGATGTACTTCCGAGCTATGGTGACGGTGG 11,393–11,425 AY705241
CHIKV CHIKV-7427 ATGGCCACCTTTGCAAGCTC 7,421–7,440 DQ443544
WEEV WEEV-8304 TCGAATGTCACGTTCCCATGCGACAAAC 8,277–8,304 AF214040
VEEV VEEV-50 AAATGGAGAAAGTTCACGTTGACATCGAGG 42–71 U34999
Plasmodium MAL-1207d TTAGATTGCTTCCTTCAGTACCTTATGAGA 547–576 HQ283215
P. falciparum1 PF1-1187 CTTTCGAGGTGACTTTTAGA 532–551 HQ283215
P. falciparum2 PF2-1182 AGCATTTCTTAGGGAATGTTGATTTTATAT 573–602 HQ283222
P. vivax PV-1173 AGAGTTTTCTCTTCGGAGTTTA 525–546 HQ283223
P. malariae PM-1181 ATTCATATTAATGAGTGTTTCTTTTAGATAGCT 569–601 AF145336
P. ovale PO-1152 TGGATGAAAARTTTTTAAATAAGAAAATTCCTTTC 391–425 JX977167
W. bancrofti WB-53 AGTATGAATGGAATTTTTAGCAATTTTTTTG 52–82 L20344
B. malayi/ B. timori BM-113 ATAAGCTTTTTTTAGTAGTTTTGGCACTTAATT 184–216 M12691
Quality controle QC TTTTTTTTTTTTTTTTTTTT   
Negative controlf NC CAGAGATACATTGACC 1,215–1,230 NM_001128925
  1. aA repeat sequence of (T)12 with an amino-labeled 3′-end was conjugated to the 3′-end of all the capture probes
  2. bGenBank accession numbers
  3. cThis capture probe was used to detect all the DENVs
  4. dThis capture probe was used to detect all the malarial parasites
  5. eA repeat sequence of (T)20 with an amino-labeled 3′-end and biotin-labeled 5′-end were used to calibrate the CL signal values during DNA hybridization
  6. fA human-original sequence was used as negative control