Skip to main content

Table 1 Microsatellites and their corresponding label and primer sequences for multiple blood feeding assay and gender preference from engorged Anopheles mosquitoes

From: Beyond the entomological inoculation rate: characterizing multiple blood feeding behavior and Plasmodium falciparum multiplicity of infection in Anopheles mosquitoes in northern Zambia

Primer Primer sequence (5’ to 3’)
CSF1PO A /HEX/ACTCCAGGGCAGTGTTCCA
CSF1PO B AGCCCATTCTCCAGCCTCC
D13S317 A /HEX/CATGGTATCACAGAAGTCT
D13S317 B CCAAAAAGACAGACAGAAAGATAG
PentaD A /HEX/AAGTAGGATCACTTGAGCCTG
PentaD B CAAGTCCTTTTTTAGATATGTGA
THO1 A /6-FAM/ATTCAAAGGGTATCTGGGCTCTG
THO1 B TGGGCTGAAAAGCTCCCGATTAT
Amelogenin A /6-FAM/CCCTGGGCTCTGTAAAGAATAGT
Amelogenin B ATCAGAGCTTAAACTGGGAAGCTG