Skip to main content

Advertisement

Table 1 Primer sequences for Babesia genus and species-specific PCRs

From: Improved molecular detection of Babesia infections in animals using a novel quantitative real-time PCR diagnostic assay targeting mitochondrial DNA

Primer name Gene target Sequence (5′-3′)
B-lsu-F Babesia lsu5-lsu4 ACCTGTCAARTTCCTTCACTAAMTT
B-lsu-R2 Babesia lsu5-lsu4 TCTTAACCCAACTCACGTACCA
Bmic-F B. microti-like lsu5-lsu4 TTGCGATAGTAATAGATTTACTGC
Bcommon-F Babesia 18S rRNA GCATTTGCGATGGACCATTCAAG
Bcommon-R Babesia 18S rRNA CCTGTATTGTTATTTCTTGTCACTACCTC
BMIC18-F B. microti-like 18S rRNA CTGCTTTATCATTAATTTCGCTTCCGAACG
BCV-F B. vogeli 18S rRNA GTTCGAGTTTGCCATTCGTT
BCC-F B. canis 18S rRNA TTGCGTTGACGGTTTGACC
BCO-F B. coco 18S rRNA CCTTTTCTTTGCTTTGTCGC
BGNC-F B. gibsoni 18S rRNA ACTCGGCTACTTGCCTTGTC
BAB722-R Babesia 18S rRNA ATGCCCCCAACCGTTCCTATTA
BCV-cox1-F4 B. vogeli cox1 TGCTATGAGTGGCGCAAATTTTG
BCV-cox1-R B. vogeli cox1 CCATACAGTAGGTATCAATCTATCT
BCC-cox1-F2 B. canis cox1 GTGCAATGAGTGGAGCAAATTTCA
BCC-cox1-R B. canis cox1 CCATACAGTTGGTATTAATCTATCC
BCO-cox1-F2 B. coco cox1 TTGTAACTTCTGTTTTACTTATGGTG
BCO-cox1-R2 B. coco cox1 AAAATAAGAATATAAACCTCAGGATGT
BG-cox1-F B. gibsoni cox1 CTTCAGCCAATAGCTTTCTGTTTG
BG-cox1-R B. gibsoni cox1 CCTGAGGCAAGTAAACCAAATAT