Skip to main content

Table 1 Details for PCR protocols used

From: Eurasian golden jackal as host of canine vector-borne protists

Parasite Gene Fragment length (bp) Primer Primer sequence (5’-3’) PCR conditions, master mix used Source
Hepatozoon spp. 18S ~670 Hep F ATACATGAGCAAAATCTCAAC 94 °C for 3 min, 35× (94 °C for 1 min, 61 °C for 1 min, 72 °C for 2 min), 72 °C for 7 min [17]
    Hep R CTTATTATTCCATGCTGCAG PPP Master Mix (TopBio s.r.o., Czech Republic)  
  18S ~1765 HAM 1 F GCCAGTAGTCATATGCTTGTC 95 °C for 5 min, 35× (95 °C for 20 s, 56 °C for 1 min, 72 °C for 1 min), 72 °C for 5 min [18]
    HPF 2R GACTTCTCCTTCGTCTAAG PCRBIO Taq DNA Polymerase (PCR Biosystems Ltd, UK)  
Piroplasmida 18S ~685 BTH 1 F CCTGAGAAACGGCTACCA CATCT 95 °C for 10 min, 40× (95 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min), 72 °C for 10 min [19]
    BTH 1R TTGCGACCATACTCCCCCCA   
   ~560 GF2 GTCTTGTAATTGGAATGA TGG 95 °C for 10 min, 40× (95 °C for 30 s, 62 °C for 1 min, 72 °C for 1 min), 72 °C for 10 min  
    GR2 CCAAAGACTTTGATTTCTCTC PPP Master Mix (TopBio s.r.o., Czech Republic)  
18S ~1730 BT1 F GGTTGATCCTGCCAGTAGT 94 °C for 30 s, 20× (94 °C for 30 s, 65-55 °C (-0.5 °C/cycle) for 30 s, 68 °C for 1 min), 20× (94 °C for 30 s, 55 °C for 30 s, 68 °C for 1 min), 68 °C for 5 min [20]
    BT outer R GGAAACCTTGTTACGACTTCTC   
   ~1670 Piro0F2 GCCAGTAGTCATATGCTTGTCTTA 94 °C for 30 s, 20× (94 °C for 30 s, 65-55 °C (-0.5 °C/cycle) for 30 s, 68 °C for 1 min), 20× (94 °C for 30 s, 55 °C for 30 s, 68 °C for 1 min), 68 °C for 5 min [21]
    BT Inner R TTC TCC TTC CTT TAA GTG ATA AG OneTaq 2x Master Mix with standard buffer (NEB Inc., USA) [20]
Babesia spp. cox1 ~1250 Bab_For1 ATWGGATTYTATATGAGTAT 95 °C for 1 min, 35× (95 °C for 15 s, 45 °C for 30 s, 72 °C for 30 s), 72 °C for 10 min [22]
    Bab_Rev1 ATAATCWGGWATYCTCCTTGG   modified
   ~975 Bab_For2 TCTCTWCATGGWTTAATTATGATAT 95 °C for 1 min, 35× (95 °C for 15 s, 45 °C for 30 s, 72 °C for 30 s), 72 °C for 10 min  
    Bab_Rev2 TAGCTCCAATTGAHARWACAAAGTG PCRBIO Taq DNA Polymerase (PCR Biosystems Ltd, UK)  
Theileria spp. cox1 ~1020 Cox1F133 GGAGAGCTAGGTAGTAGTGGAGATAGG 95 °C for 1 min, 35× (95 °C for 15 s, 63 °C for 15 s, 72 °C for 30 s), 72 °C for 10 min [21]
    Cox1R1130 GTGGAAGTGAGCTACCACATACGCTG   
   ~985 Cox_cladeI_Fw2 GTAGTGGAGATAGGTTCATAGC 95 °C for 1 min, 35× (95 °C for 15 s, 55 °C for 15 s, 72 °C for 30 s), 72 °C for 10 min This study
    Cox_cladeI_Rev2 TGTATCGTGTAGTGACACGTC PCRBIO Taq DNA Polymerase (PCR Biosystems Ltd, UK)  
Leishmania spp. ITS1 ~280 ITS-219 F AGCTGGATCATTTTCCGATG qPCR: 95 °C for 5 min, 45× (95 °C for 5 s, 57 °C for 15 s, 72 °C for 15 s), melting from 60 to 95 °C at 1 °C/s [26]
    ITS-219R ATCGCGACACGTTATGTGAG iQSYBER Green Supermix (BioRad Inc., USA)  
  ITS1-5.8S ~300 LITSR CTGGATCATTTTCCGATG 95 °C for 3 min, 40× (95 °C for 20 s, 53 °C for 35 s, 72 °C for 60 s), 72 °C for 5 min [27]
    L5.8S ACACTCAGGTCTGTAAAC   
      EmeraldAmp (TaKaRa Clontech, Japan)