Skip to main content

Table 1 The primers used in the present study

From: Trypanosoma vivax is the second leading cause of camel trypanosomosis in Sudan after Trypanosoma evansi

Parasite Method Primer Sequence (5′–3′) Target gene Fragment size (bp) Reference
T. evansi KIN-PCR Kin1 GCGTTCAAAGATTGGGCAAT ITS1 540 Desquesnes et al. [20]
   Kin2 CGCCCGAAAGTTCACC    
T. evansi RoTat 1.2-PCR ILO7957 GCCACCACGGCGAAAGAC RoTat 1.2 VSG 488 Urakawa et al. [21]
   ILO8091 TAATCAGTGTGGTGTGC    
T. evansi ITS-PCR IR1 GCTGTAGGTGAACTTGCAGCAGCTGGATCATT ITS 1100 Da Silva et al. [23]
   IR2 GCGGGTAGTCCTGCCAAACACTCAGGTCTG    
T. vivax KIN-PCR Kin1 GCGTTCAAAGATTGGGCAAT ITS1 300 Desquesnes et al. [20]
   Kin2 CGCCCGAAAGTTCACC    
T. vivax TviCatL-PCR DTO 155 TTAAAGCTTCCACGAGTTCTTGATGATCCAGTA Cathepsin L-like 200 Cortez et al. [22]
   TviCatL1 GCCATCGCCAAGTACCTCGCCGA