Skip to main content

Table 3 Sequences of primers based on the cytochrome b (cytb) gene that were used to identify the food sources of anopheline mosquitos [24]

From: Molecular identification of Plasmodium spp. and blood meal sources of anophelines in environmental reserves on São Luís Island, state of Maranhão, Brazil

Food source tested Primer sequence Product size (bp)
Domestic cat TTCTCAGGATATACCCTTGACA 180
GAAAGAGCCCATTGAGGAAATC
Human TTCGGCGCATGAGCTGGAGTCC 228
GTRTARTAGGGRTGRAATC
Domestic dog GAACTAGGTCAGCCCGGTACTT 153
CGGAGCACCAATTATTAACGGC
Birds GACTGTGACAAAATCCCNTTCCA 508
GTCTTCATCTYHGGYTTACAAGAC
Reaction 94 °C for 2 min; 35 cycles of 94 °C for 30 s, 54–70 °Ca for 30 s, 72 °C for 30 s; and a final extension step at 72 °C for 20 min  
  1. aDepending on the annealing temperature of each oligonucleotide (see Chang et al. [24])