Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers designed for amplification of the partial sequences of Echinococcus multilocularis cob and nad2 genes by PCR

From: Genetic variation of mitochondrial genes among Echinococcus multilocularis isolates collected in western China

Primer Sequence (5′-3′)
EmCob-F GTTTAAACTGGTAGATTGTGGTTC
EmCob-R CTCCACAGTAGAAATCACCATCA
EmNad2-F GCGTTGATTCATTGATACATTGT
EmNad2-R TAGTAAAGCTCAAACCGAGTTCT