Skip to main content

Advertisement

Table 2 Different groups and strains of Wolbachia present in the mosquito species Aedes albopictus (n = 10), Culex quinquefasciatus (n = 5), Armigerus subalbatus (n = 4) and Mansonia uniformis (n = 2)

From: Distribution and phylogeny of Wolbachia strains in wild mosquito populations in Sri Lanka

Wolbachia super-group Strain Primers (5′-3′) PCR product (bp) AAa CQa ARa MNb
Group A   136 F: TGAAATTTTAGCTCTTTTC
691R: AAAAATTAAACGCTACTCCA
556 10 03
  Mel 308 F: TTAAAGATGTAACATTTG
691R: AAAAATTAAACGCTACTCCA
405
  AlbA 328 F: CCAGCAGATACTATTGCG
691R: AAAAATTAAACGCTACTCCA
379 10 02
Group B   81 F: TGGTCCAATAAGTGATGAAGAAAC
522R: ACCAGCTTTTGCTTGATA
442 10 05 02
  Pip 183 F: AAGGAACCGAAGTTCATG
691R: AAAAATTAAACGCTACTCCA
501 10 05 01
  1. aFrom Central Province
  2. bFrom Southern Province
  3. AbbreviationsAA Aedes albopictusCQ Culex quinquefasciatus, AR Armigerus subalbatus, MN Mansonia uniformis