Skip to main content

Table 1 List of primers and gene markers used in this study as MLST scheme

From: Evaluation of a Multilocus Sequence Typing (MLST) scheme for Leishmania (Viannia) braziliensis and Leishmania (Viannia) panamensis in Colombia

Target gene Enzyme entry Chromosomal location Gene length (bp) Amplicon size (bp) Primer sequence Reference
Glucose-6-phosphate dehydrogenase (g6pdh) EC 1.1.1.49 20 and 34aa 1,686 881 Fw: ATGGAAGCGTGTGATCGAAT
Rv: GGCTCAACACACTTCAGCAA
[16]
Phosphoglucomutase (pgm) EC 5.4.2.2 21 1,770 529 Fw: CAGAGAAGCTGACGTCCCAG
Rv: GACGGGTTCACGAAGAAGCG
[21]
Mannose phosphate isomerase (mpi) EC 5.3.1.8 32 1,287 681 Fw: GGCAAGATGTATGCGGAGTT
Rv: CTCCCCAGGAACCATCTGTA
[16]
Alanine aminotransferase (alat) EC 2.6.1.21 12 1,494 589 Fw: GTGTGCATCAACCCMGGGAA
Rv: CGTTCAGCTCCTCGTTCCGC
[21]
Aspartate aminotransferase (asat) EC 2.6.1.1 24 1,169 684 Fw: ACGAGCGCCGTCCGYAA
Rv: TTCCYMCATCCACCAAGC
[15]
Isocitrate dehydrogenase (icd) EC 1.1.1.42 33 1,278 1,022 Fw: GAATCGGGAAGGAGATCACA
Rv: CATCATAGCCCCAGAGAGGA
[16]
Cytochrome b (cytb)   Maxicircle   618 Fw: AGCGGAGAGRARAGAAAAGG
Rv: GYTCRCAATAAAATGCAAATC
 
  1. a g6pdh gene is present on chromosomes 20 and 34a only in L. (V) braziliensis; it is present on chromosome 20 in L. (V) panamensis uniquely