Skip to main content

Advertisement

Table 1 Primers and PCR amplification conditions

From: A novel zoonotic Anaplasma species is prevalent in small ruminants: potential public health implications

Target gene Primer name Primer sequence (5'-3') Annealing temperature (°C) Amplicon size (bp) Reference
gltA Outer-f GCGATTTTAGAGTGYGGAGATTG 55 1031 [4]
Outer-r TACAATACCGGAGTAAAAGTCAA    
Inner-f TCATCTCCTGTTGCACGGTGCCC 60 594 [8]
Inner-r CTCTGAATGAACATGCCCACCCT    
16S rRNA Forward GCAAGTCGAACGGACCAAATCTGT 58 1261 [8]
Reverse CCACGATTACTAGCGATTCCGACTTC    
groEL Forward TGAAGAGCATCAAACCCGAAG 55 874 [8]
Reverse CTGCTCGTGATGCTATCGG    
msp4 Forward GGGTTCTGATATGGCATCTTC 53 656 This study
Reverse GGGAAATGTCCTTATAGGATTCG