Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer designed for pvgama gene amplification

From: PvGAMA reticulocyte binding activity: predicting conserved functional regions by natural selection analysis

Target Primer sequence (5’ – 3’)a MT (°C) Product size (bp) aa position
pvgama Fwd: ATGAAGTGCAACGCCTCC
Rev: AAAAATGAATAGGAGCAACG
58 2313 1 to 771
pvgama -Nt Fwd: ATACGGAATGGAAACAACC
Rev: AGTCGGTTCGTTATTCTCG
1284 22 to 449
pvgama -Ct Fwd: CTGCTCAAGAACACGAAC
Rev: GCTTCCACTCTGCAATTC
948 434 to 749
pvgama -CR1 Fwd: GACGATCATCTGTGTTCAAAAA
Rev: GACCTCATTTTTGGACTTCTC
60 666 87 to 308
pvgama -VR1 Fwd: GGCGCCTTCCTGCAGTC
Rev: CATTAACATGGTGTTGTCGCT
438 330 to 475
pvgama -CR2 Fwd: CAGGCGGCCATCTTACTAA
Rev: GCTCCCGTTGACGCCCTT
321 482 to 588
pvgama -VR2 Fwd: GCCGCAAACGCAGACGCC
Rev: GTTTGCCGAGAAGCTTCCAC
384 626 to 753
  1. Abbreviations: Nt and Ct amino and carboxyl terminal; CR conserved region, VR variable region; Fwd forward, Rev reverse, MT melting temperature, bp base pair, aa amino acid
  2. aProtein’s expression start codon was included in forward primer’s 5’ end