Skip to main content

Advertisement

Table 1 PvRBSA mutations found by comparing the nucleotide and amino acid sequences of P. vivax VCG-I and Sal-1 strains

From: Characterising PvRBSA: an exclusive protein from Plasmodium species infecting reticulocytes

Changes in PvRBSA nucleotide sequence in Sal-I and VCG-I P. vivax strainsa Changes in PvRBSA aa sequences in Sal-I and VCG-I P. vivax strainsa Mutation
c.29A > G p.Tyr10Cys Non-synonymous
c.391_411delCTAACAGGAAGTAATGAATCC p.Leu131_Ser137delb Deletion
c.533 T > G p.Phe178Cys Non-synonymous
c.796A > G p.Lys266Gly Non-synonymous
c.797A > G p.Lys266Gly Non-synonymous
c.801 T > A p.Ser267Arg Non-synonymous
c.803A > C p.Tyr268Ser Non-synonymous
c.808C > G p.His270Asp Non-synonymous
c.845C > T p.Pro282Leu Non-synonymous
c.1029 T > C p.Lys343Lys Synonymous
c.1091G > C p.Trp364Ser Non-synonymous
  1. aNucleotide and amino acid positions are numbered according to the Sal-I reference strain sequence alignment with the VCG-I strain
  2. bRelative location for a region having 4 identical tandem repeats from amino acid position 103 to 130 in the VCG-I strain