Skip to main content

Table 2 Primers used for PCR

From: Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia, Russia

Amplified locus Primer sequences (5'-3') Annealing temperature Reference
Ixodes sp. ITS2 F-ITS2 (cacactgagcacttactctttg)
R1-ITS2 (actggatggctccagtattc)
57 °C [58]
I. persulcatus cox1 gene Ixodes-F (acctgatatagctttccctcg)
Ipers-R (ttgattcctgttggaacagc)
55 °C [69]
I. pavlovskyi cox1 gene Ixodes-F (acctgatatagctttccctcg)
Ipav-R (taatccccgtggggacg)
55 °C [69]
TBEV E-NS1 genes E7 (ggcatagaaaggctgacagtg)
E10 (gatacctctctccacacaaccag)
52 °C [34]
E9 (acagtgataggagaacacgcctggg)
E8 (cagccaggaggaagctcatggac)
52 °C [34]
KEMV segment 1 Kem1s_1 (attcaaattacgacacgcacatgac)
Kem1s_2 (gtatcgtcgccgacgtacatctc)
56 °C [70]
Kem1s_3 (gctcatcgaagcgggatacgg)
Kem1s_4 (gcgtagagttctctcccgacagatg)
56 °C [70]
Borrelia burgdorferi (s.l.) 5S-23S rRNA
intergenic spacer
NC1 (cctgttatcattccgaacacag)
NC2 (tactccattcggtaatcttggg)
50 °C [14]
NC3 (tactgcgagttcgcgggag)
NC4 (cctaggcattcaccatagac)
54 °C [71], modified
B. miyamotoi
glpQ gene
Q1 (caccattgatcatagctcacag)
Q4 (ctgttggtgcttcattccagtc)
50 °C [44]
Q3 (gctagtgggtatcttccagaac)
Q2 (cttgttgtttatgccagaagggt)
54 °C [44]
B. burgdorferi (s.l.)
p83/100 gene
F7 (ttcaaagggatactgttagagag)
F10 (aagaaggcttatctaatggtgatg)
50 °C This study
F5 (acctggtgatgtaagttctcc)
F12 (ctaacctcattgttgttagactt)
54 °C This study
B. burgdorferi (s.l.)
clpA gene
clpAF1237 (aaagatagatttcttccagac)
clpAR2218 (gaatttcatctattaaaagctttc)
55 → 48 °C [72]
clpAF1255 (gacaaagcttttgatattttag)
clpAR2104 (caaaaaaaacatcaaattttctatctc)
50 °C [72]
Anaplasmataceae
16S rRNA gene
Ehr1 (gaacgaacgctggcggcaagc)
Ehr2 (agtaycgraccagatagccgc)
57 °C [45]
Ehr3 (tgcataggaatctacctagtag)
Ehr4 (ctaggaattccgctatcctct)
60 °C [45]
A. phagocytophilum
16S rRNA gene
HGE1 (cggattattctttatagcttgc)
HGE2 (cttaccgaaccgcctacatg)
55 °C [45]
E. muris
16S rRNA gene
Em1 (cgaacggatagctacccatagc)
Em2 (cgctccaaagttaagctttggt)
55 °C [45]
Anaplasmataceae
groESL operon
HS1-f (cgycagtgggctggtaatgaa)
HS6-r (ccwccwggtacwacaccttc)
55 °C [73], modified
HS3-f (atagtyatgaaggagagtgat)
HSVR (tcaacagcagctctagtwg)
50 °C [74]
Rickettsia spp.
gltA gene
glt1 (gattgctttacttacgaccc)
glt2 (tgcatttctttccattgtgc)
52 °C [49]
glt3 (tatagacggtgataaaggaatc)
glt4 (cagaactaccgatttctttaagc)
53 °C [49]
Ca. R. tarasevichiae” gltA gene RT1 (tactaaaaaagtcgctgttcattc)
RT2 (tgttgcaaacatcatgcgtaag)
56 °C [49]
SFGR gltA RH1 (gtcagtctactatcacctatatag)
RH3 (taaaatattcatctttaagagcga)
54 °C [49]
This study
Babesia spp.
18S rRNA gene
BS1 (gacggtagggtattggcct)
BS2 (attcaccggatcactcgatc)
58 °C [46]
BS3 (taccggggcgacgacgggtg)
BS5 (cgaggcagcaacgggtaacg)
BS4 (agggacgtagtcggcacgag)
62 °C [46]