Skip to main content

Advertisement

Table 2 Primers used for PCR

From: Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia, Russia

Amplified locus Primer sequences (5'-3') Annealing temperature Reference
Ixodes sp. ITS2 F-ITS2 (cacactgagcacttactctttg) R1-ITS2 (actggatggctccagtattc) 57 °C [58]
I. persulcatus cox1 gene Ixodes-F (acctgatatagctttccctcg) Ipers-R (ttgattcctgttggaacagc) 55 °C [69]
I. pavlovskyi cox1 gene Ixodes-F (acctgatatagctttccctcg) Ipav-R (taatccccgtggggacg) 55 °C [69]
TBEV E-NS1 genes E7 (ggcatagaaaggctgacagtg) E10 (gatacctctctccacacaaccag) 52 °C [34]
E9 (acagtgataggagaacacgcctggg) E8 (cagccaggaggaagctcatggac) 52 °C [34]
KEMV segment 1 Kem1s_1 (attcaaattacgacacgcacatgac) Kem1s_2 (gtatcgtcgccgacgtacatctc) 56 °C [70]
Kem1s_3 (gctcatcgaagcgggatacgg) Kem1s_4 (gcgtagagttctctcccgacagatg) 56 °C [70]
Borrelia burgdorferi (s.l.) 5S-23S rRNA intergenic spacer NC1 (cctgttatcattccgaacacag) NC2 (tactccattcggtaatcttggg) 50 °C [14]
NC3 (tactgcgagttcgcgggag) NC4 (cctaggcattcaccatagac) 54 °C [71], modified
B. miyamotoi glpQ gene Q1 (caccattgatcatagctcacag) Q4 (ctgttggtgcttcattccagtc) 50 °C [44]
Q3 (gctagtgggtatcttccagaac) Q2 (cttgttgtttatgccagaagggt) 54 °C [44]
B. burgdorferi (s.l.) p83/100 gene F7 (ttcaaagggatactgttagagag) F10 (aagaaggcttatctaatggtgatg) 50 °C This study
F5 (acctggtgatgtaagttctcc) F12 (ctaacctcattgttgttagactt) 54 °C This study
B. burgdorferi (s.l.) clpA gene clpAF1237 (aaagatagatttcttccagac) clpAR2218 (gaatttcatctattaaaagctttc) 55 → 48 °C [72]
clpAF1255 (gacaaagcttttgatattttag) clpAR2104 (caaaaaaaacatcaaattttctatctc) 50 °C [72]
Anaplasmataceae 16S rRNA gene Ehr1 (gaacgaacgctggcggcaagc) Ehr2 (agtaycgraccagatagccgc) 57 °C [45]
Ehr3 (tgcataggaatctacctagtag) Ehr4 (ctaggaattccgctatcctct) 60 °C [45]
A. phagocytophilum 16S rRNA gene HGE1 (cggattattctttatagcttgc) HGE2 (cttaccgaaccgcctacatg) 55 °C [45]
E. muris 16S rRNA gene Em1 (cgaacggatagctacccatagc) Em2 (cgctccaaagttaagctttggt) 55 °C [45]
Anaplasmataceae groESL operon HS1-f (cgycagtgggctggtaatgaa) HS6-r (ccwccwggtacwacaccttc) 55 °C [73], modified
HS3-f (atagtyatgaaggagagtgat) HSVR (tcaacagcagctctagtwg) 50 °C [74]
Rickettsia spp. gltA gene glt1 (gattgctttacttacgaccc) glt2 (tgcatttctttccattgtgc) 52 °C [49]
glt3 (tatagacggtgataaaggaatc) glt4 (cagaactaccgatttctttaagc) 53 °C [49]
Ca. R. tarasevichiae” gltA gene RT1 (tactaaaaaagtcgctgttcattc) RT2 (tgttgcaaacatcatgcgtaag) 56 °C [49]
SFGR gltA RH1 (gtcagtctactatcacctatatag) RH3 (taaaatattcatctttaagagcga) 54 °C [49] This study
Babesia spp. 18S rRNA gene BS1 (gacggtagggtattggcct) BS2 (attcaccggatcactcgatc) 58 °C [46]
BS3 (taccggggcgacgacgggtg) BS5 (cgaggcagcaacgggtaacg) BS4 (agggacgtagtcggcacgag) 62 °C [46]