Skip to main content

Table 1 Oligonucleotide primers used for PCR amplification and sequencing

From: Symbiont dynamics of the Tibetan tick Haemaphysalis tibetensis (Acari: Ixodidae)

Primer Species Target gene Nucleotide sequence (5′–3′) Annealing temperature (°C) Approx. product size (bp) Reference
Eub27F Eubacteria 16S rRNA AGAGTTTGATCCTGGCTCAG 55 1,500 [32]
Rickettsia354F Rickettsia 16S rRNA CAGCAATACCGAGTGAGTGATGAAG 56 350 [33]
Actin-F Haemaphysalis actin CGTTCCTGGGTATGGAATCG 55 100 [4]
Actin-R Haemaphysalis actin TCCACGTCGCACTTCATGAT