Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer information for nine microsatellite loci screened in Ae. aegypti from Yunnan Province, China

From: The genetic diversity and population structure of domestic Aedes aegypti (Diptera: Culicidae) in Yunnan Province, southwestern China

Locus Repeat motif Primer sequence (5′-3′) Annealing temperature (°C) Allele size (bp) Fluorescence labeling Reference
SQM1 CT10(TT)CT F: AATCGTGACGCGTCTTTTG;
R: TAACTGCATCGAGGGAAACC
54 233–239 5′-HEX [27]
SQM2 GA15 F: CAAACAACGAACTGCTCACG;
R: TCGCAATTTCAACAGGTAGG
53 157–183 5′-FAM [27]
SQM3 CAT7 F: ATTGGCGTGAGAACATTTTG;
R: GAGGAGTGAGCAGATAGGAGTG
58 156–186 5′-FAM [27]
SQM4 TAGA8 F: GCCAAAAACCAACAAACAGG;
R: AATCGACCCGACCAATAACA
53 286–290 5′-TAMRA [27]
SQM5 ATA36 F: GGAGCATTCATAGAGAATTGTCA;
R: GAGATGAACCAGTCATAGGGC
56 110–116 5′-FAM [27]
SQM6 (TTTA)7(T)14 F: CGACAGATGGTTACGGACGG;
R: GTC CCG CTC CAA AAA TGC CC
58 228 5′-FAM [23]
SQM7 AG4 F: AAAACCTGCGCAACAATCAT;
R: AAGGACTCCGTATAATCGCAAC
56 147–169 5′-FAM [36]
SQM8 AG5 F: TGATCTTGAGAAGGCATCCA;
R: CGTTATCCTTTCATCACTTGTTTG
55 170–180 5′-FAM [36]
SQM9 AC1 F: TCCGGTGGGTTAAGGATAGA;
R: ACTTCACGCTCCAGCAATCT
55 193–209 5′-FAM [36]