Skip to main content

Table 1 Primer sequences for quantitative real-time PCR

From: Clonorchis sinensis lysophospholipase A upregulates IL-25 expression in macrophages as a potential pathway to liver fibrosis

Gene Sequence (5′-3′) Accession number
α-SMA Forward: CCAGGGCTGTTTTCCCATCC NM_001613.2
Reverse: GCTCTGTGCTTCGTCACCCA  
IL-25 Forward: TCTACCGAGTCTCCTTGGCT NM_080729.3
Reverse: ATTGTACACCTGGCCCTCTC  
TNF-α Forward: GACAGTGACCTGGACTGTGG NM_013693.3
Reverse: TGAGACAGAGGCAACCTGAC  
iNOS Forward: ACCTTGTTCAGCTACGCCTT NM_010927.3
Reverse: CATTCCCAAATGTGCTTGTC  
IL-6 Forward: AGTCCGGAGAGGAGACTTCA NM_031168.1
Reverse: ATTTCCACGATTTCCCAGAG  
PKA Forward: CCTGTTCCCACCCTATCACT NM_001277898.1
Reverse: TGGAAGCCATCACTCAGTCT  
B-Raf Forward: TCCACGTTGGCATTGTTAGT XM_006505358.2
Reverse: TCACTCCTGTAAGCGTCCTG  
ERK1 Forward: TCCCAGGAGGACCTTAATTG NM_011952.2
Reverse: AAGGTTAACATCCGGTCCAG  
ERK2 Forward: TGAGGATGTTAGGCTTCGTCT NM_001038663.1
Reverse: AAAGTCCACTCCCACAATGC  
β-actina Forward: TGGACTTCGAGCAAGAGATG NM_001101.3
Reverse: GAAGGAAGGCTGGAAGAGTG  
β-actinb Forward: GGAATGGGTCAGAAGGACTC NM_007393.5
Reverse: CATGTCGTCCCAGTTGGTAA  
  1. a Homo sapiens
  2. b Mus musculus